Skip to content

Configuration

All configuration lives in resources/config/. The config.yaml at the repository root is a symlink to resources/config/config.yaml.


config.yaml

Key settings to review before running:

Trimmer

trimmer: fastp   # fastp (default) or cutadapt

Both options run FastQC before and after trimming and feed into MultiQC.

Cutadapt requires adapter sequences in params.cutadapt. fastp is configured in params.fastp.extra, which by default passes:

--detect_adapter_for_pe --adapter_fasta resources/adapters/illumina_adapters.fa --trim_poly_g --trim_poly_x

These are set explicitly rather than relying on fastp's defaults, because the defaults are conditional and quietly do less than expected:

  • Adapter detection is weaker for paired-end input. fastp only auto-detects adapter sequences for single-end reads. For paired-end it infers adapters from per-read overlap analysis, which leaves residual 3' adapter behind when the overlap is short or low quality. --detect_adapter_for_pe turns sequence detection on, and --adapter_fasta additionally trims the known TruSeq/Nextera sequences.
  • polyG trimming depends on the read header. fastp enables it only when it recognises a NextSeq/NovaSeq instrument ID in the read name, and for archived data that is unreliable. Deflines differ across SRA datasets:
@SRR36840144.1 A00814:609:HMHW7DSX3:1:1101:10004:4726 length=151
@SRR36840144.1 1 length=151
@A00814:715:HVFYYDRX2:1:1101:18114:1016 1:N:0:...          (native)

Some runs carry the original Illumina name and some do not, and even when present it is not in the leading field where native output puts it. So whether 2-colour polyG tails get trimmed can differ between datasets that are meant to be compared directly. --trim_poly_g removes the dependence on header parsing, and --trim_poly_x additionally catches polyA read-through, which the adapter panel cannot cover.

Adapter panel

resources/adapters/illumina_adapters.fa is a deliberately comprehensive guard set, not a minimal one, so the same file can be reused across DNA and RNA library types without editing. It covers:

Group Constructs
TruSeq Read 1 / Read 2 adapters, indexed-adapter pre-index segment, post-index constant region, PE bottom adapter
Flowcell primers P5, P7 (full and short forms)
Sequencing primers Read 1, Read 2
Nextera / Tn5 mosaic end (both orientations), Read 1 / Read 2 adapters, i5 and i7 transposome sequences
Tagmentation / RNA prep Illumina DNA PCR-Free, Illumina Stranded mRNA and Total RNA Prep
Small RNA TruSeq Small RNA 5' and 3' adapters

Sequences are taken from Illumina's adapter-trimming reference and Illumina Adapter Sequences (doc #1000000002694).

Two constructs are worth calling out because they are commonly omitted and were the source of real misassignments: the P5/Read 1 sequencing primer (ACACTCTTTCCCTACACGACGCTCTTCCGATCT) and the post-index constant region (ATCTCGTATGCCGTCTTCTGCTTG, the reverse complement of the P7 primer). Reads consisting entirely of these have been mistaken for viral genomes, because some public assemblies contain untrimmed adapter at the matching position.

Because the panel favours coverage over minimality, a few short entries (16-20 bp) carry a slightly higher chance of spurious trimming than the 33-61 bp constructs. That trade is intentional. Set params.fastp.extra: "" to restore fastp's stock behaviour, or point --adapter_fasta at a trimmed-down file for a specific library type.

Assembler(s)

assemblers:
  - megahit       # default
# - metaspades    # uncomment to also run metaSPAdes

Both assemblers can run in parallel. MEGAHIT is the default — faster and more memory-efficient for most metagenomes. metaSPAdes may produce better assemblies for lower-complexity samples but requires substantially more RAM.

Host filter

host_filter:
  genome: /path/to/host_genome.fna
  db_dir: /path/to/bt2_index_dir/

The index name is derived from the FASTA filename stem, so genome: /path/human.fna expects /path/human.*.bt2 in db_dir.

A complete existing index is detected and reused — useful for shared references, where rebuilding a human genome costs hours. The index is built only when all six parts (.1, .2, .3, .4, .rev.1, .rev.2, in either .bt2 or .bt2l form) are not already present, so a partial index left by an interrupted build is rebuilt rather than silently accepted. Completion is tracked with a <stem>.bowtie2_build.done sentinel, since bowtie2 chooses between the small and large index layouts based on reference size and the output filenames cannot be declared up front.

Prototype selection

params:
  prototypes:
    n: 10                  # representative samples selected for binning
    min_seqs: 50           # depth floor; use 10000000 for real data
    max_seqs: 200000000    # depth ceiling
    exclude: []            # samples barred from the prototype pool

Both depth bounds are compared against fastp's total_reads, which counts both mates — a library described as "50M reads" is 100M by this measure, so the ceiling bites at half the depth you might expect.

max_seqs excludes the deepest samples, and those are exactly the ones that make the best differential-coverage basis for binning. The previous 100000000 default silently dropped the top 4% of a 341-sample gut cohort (deepest run 138.5M reads) without warning. Sketching is cheap, so the ceiling is now high enough to retain everything and serves only as a guard against a pathological input. Check your own depth distribution before lowering it.

n determines how many prototype samples are selected by prototype_selection and used by generate_binning_config to populate binning.txt. Setting n higher produces better binning coverage but more assembly/mapping jobs.

exclude lists samples by name that may never serve as a prototype:

params:
  prototypes:
    exclude:
      - Control_Sample

A run control is the usual case. It should still be trimmed, screened and profiled, because you want to know what is in it, but it is not part of the biology and has no business forming a differential-coverage basis for binning. The depth bounds cannot express this, since a control can be sequenced as deeply as any real sample.

A name that matches no sample in the metadata table stops the run at load with an error naming it. Silently ignoring a typo would leave the very sample you meant to exclude still acting as a coverage basis, which is the failure this option exists to prevent.

Mappers and binners (binning pipeline)

mappers:
  - minimap2      # default
# - bowtie2       # uncomment to also run bowtie2

binners:
  - concoct
  - metabat2
  - maxbin2
  - semibin2

Four binners run independently. MetaBAT2, MaxBin2 and CONCOCT are composition-plus-coverage clustering with different distance measures; SemiBin2 uses a self-supervised neural embedding — a different mechanism, so it tends to fail differently, which is the point of adding it. SemiBin2 is deterministic given seed: (below); MaxBin2 is the one binner that does not reproduce itself run to run. Their bin sets are combined by the consolidation tool.

Bin consolidation

params:
  consolidation:
    tool: binette        # binette (default) or das_tool

The consolidation tool reconciles the four per-binner bin sets into one non-redundant set of MAGs per sample.

  • Binette (default) scores candidate bins with CheckM2 — the same estimator that judges the final MAGs in MAG QC — and builds extra candidates from the intersection, difference and union of overlapping input bins. Its score is completeness − contamination_weight × contamination (params.binette, default weight 2). On four primate-gut arms, holding reads, assembly, mapping and all binners constant, it recovered ~49% more usable genomes than DAS_Tool on identical inputs.
  • DAS_Tool scores candidates with 51 bacterial single-copy genes and a redundancy heuristic. params.das_tool.score_threshold (default 0.5) sets how strict selection is: the score combines single-copy-marker completeness and purity, so raising it keeps fewer, cleaner bins and lowering it keeps more. 0.5 is DAS_Tool's own default and is deliberately conservative — a bin that only one binner resolves is discarded even when it is a real organism that appears in no kept bin. Comparing this pipeline against a published single-binner study on identical reads, all 70 genomes that study recovered and this pipeline did not were present among the per-binner bins and dropped here. Lower it only with the GUNC pass rate and contamination of the whole MAG set in view.

Selected FASTAs land in output/selected_bins/{mapper}/DAS_Tool_Fastas/ or .../Binette_Fastas/; everything downstream reads whichever one the run chose. Override per run with --binette / --das-tool, and run an arm both ways to compare — both directories can coexist. For Binette, Winning_Binner in mag_summary.tsv can name more than one binner (metabat2+concoct).

Strain heterogeneity (CMSeq)

params:
  cmseq:
    mincov: 10
    minqual: 30
    dominant_frq_thrsh: 0.8
    min_positions: 100
    min_mapq: 20
    min_read_identity: 0.95

After MAGs are selected, each sample's own host-filtered reads are mapped back to its own MAGs and CMSeq counts positions carrying more than one allele. This catches a MAG that is a clean consensus of several co-resident strains of one species — something CheckM2 (which sees material from another species) and GUNC (which sees chimerism against a reference) cannot detect.

Thresholds match Pasolli 2019 and Sanders 2023 so the values are comparable with the published genome databases; changing them breaks that comparison. The two read filters (min_mapq, min_read_identity) remove reads from unbinned relatives that would otherwise read out as false polymorphism — without them, strain heterogeneity partly measures how much of the community failed to bin. Skip the whole step with --skip-cmseq, in which case Strain_Heterogeneity and SH_Positions_Evaluated are written as NA.

Viral / plasmid discovery

params:
  genomad:
    db_path: /path/to/genomad_db      # genomad download-database <dir>
    extra: ''                          # e.g. --conservative for higher-precision calls
  checkv:
    db_path: /path/to/checkv-db-v1.5  # checkv download_database <dir>

geNomad classifies viral and plasmid contigs straight from the assemblies; CheckV then scores viral completeness / contamination. Per-sample, parallel to the MAG track, requested with the virus_all target. See Viral / plasmid track.

Reproducibility seed

seed: 8675309

One seed handed to every tool that accepts one (MetaBAT2, CONCOCT, SemiBin2, …). The value itself is meaningless; fixing it is what makes a binning run reproducible, since these tools otherwise default to a wall-clock or system-chosen seed. Override for one tool with params.<tool>.seed (or params.semibin2.random_seed).

Read-level profiling

biobakery:
  - metaphlan

profilers:
  - kraken2
  - bracken

Both lists are honoured: removing an entry drops that tool's targets from the run. (biobakery previously had no effect, because the metaphlan table was required by rule all regardless of what the list said.)

For a single run, --skip-kraken and --skip-metaphlan do the same thing without editing the config:

./run_magmaker.sh --profile resources/profiles/demon --skip-kraken

They are separate flags because the tools are useful independently. An analysis that takes its taxonomy from GTDB-Tk on the MAGs needs neither; one that wants community profiles may still want metaphlan while skipping kraken2, which reads a ~200 GB index per sample and is the heaviest I/O in the pipeline for what it contributes.

When kraken2 does run, resources: [kraken_slots=N] in the profile caps how many of its jobs run at once within a workflow. The demon profile sets 2. Without a cap, every sample in an arm competes for the same index read simultaneously and jobs are cancelled on wall clock while doing almost no work.

Taxonomy and profiling

params:
  metaphlan:
    db_path: /path/to/metaphlan_db/
    db_name: mpa_vJan25_CHOCOPhlAnSGB_202503
  kraken2:
    db: /path/to/Kraken2_db_Standard
    bracken-db: /path/to/Kraken2_db_Standard   # MUST be the same build as db
  gtdbtk:
    db_path: /path/to/gtdbtk/release232/
    min_perc_aa: 10                # classify path: GTDB-Tk's own default
    min_perc_aa_no_classify: 0     # --skip-gtdbtk-classify path: keep every genome
  checkm2:
    db_path: /path/to/checkm2/uniref100.KO.1.dmnd   # leave empty to auto-download
  gunc:
    db_path: /path/to/gunc_db_progenomes2.1.dmnd     # leave empty to auto-download

bracken-db must point at the same Kraken2 build as db — Bracken's .kmer_distrib files are build-specific and mixing them silently produces wrong abundances.

The two min_perc_aa values are the alignment-coverage floor GTDB-Tk applies before dropping a genome into filtered.tsv. min_perc_aa (default 10) applies when classify will follow; min_perc_aa_no_classify (default 0) applies under --skip-gtdbtk-classify, where the point is to have an MSA_Percent for every genome rather than silently drop the weakest. See the GTDB-Tk stages section of Output.

See Database setup for download instructions.

Threads and memory

threads:
  megahit: 16
  checkm2: 16
  gtdbtk: 16
  metaphlan: 8
  # ... one entry per rule

mem_mb:
  megahit: 256000    # ceiling; actual request auto-scales with input size
  spades: 256000
  checkm2: 32000
  gtdbtk: 128000     # first attempt
  gtdbtk_max: 320000 # ceiling; retries request gtdbtk * attempt, capped

Assembly rules (megahit, metaspades) auto-scale their memory request based on input size (max(16000, input_size_mb × 10)) up to the configured ceiling. All other rules use their configured value directly.

GTDB-Tk is the one to watch, and it escalates. Its memory is dominated by pplacer during classify_wf, and the requirement scales with the number of bins: on a 341-sample gut cohort, 324 samples finished inside 128 GB while 17 were OOM-killed. The failure surfaces only at the very end of the pipeline, since MAG QC is the last stage.

Sizing every request for the worst case is the wrong fix. mem_mb is a scheduler reservation, so a flat 300 GB request confines every sample to whichever nodes are that large and serialises the stage. Instead gtdbtk is the first attempt and gtdbtk_max the ceiling; the rule requests gtdbtk × attempt capped at gtdbtk_max, with retries from retries.run_gtdbtk. Most samples schedule anywhere on the first try and only the heavy ones wait for a large node:

attempt request
1 128 GB
2 256 GB
3 320 GB (capped)

Check what your nodes can actually supply with sinfo -o "%n %m". If none reach the ceiling, pass --scratch_dir to gtdbtk instead: pplacer then mmaps the reference to disk, needing far less RAM but running slower.

Runtimes are set per rule in resources/snakefiles/*.smk via runtime_escalate() (with an optional config['runtime'] override, parallel to mem_mb), and grow on each retry just like memory. Note that fastp is the rule most exposed to slow shared storage, since it reads every raw FASTQ: it is given 360 minutes rather than the 120-minute default, after a 2.4 GB library was cancelled four minutes inside the limit while the filesystem was saturated. The compute is minutes; the variance is I/O.

Every rule that escalates also carries a retries: entry in config.yaml; without one, attempt never exceeds 1 and the escalation is inert. The retries: block also covers tools whose parallel plumbing fails transiently under high cluster concurrency (DAS_Tool, GUNC, CheckM2 — all DIAMOND-based), where a fresh attempt lands in a lower-contention window and clears it.


metadata.txt

One tab-separated table describing every sequencing run. This replaces the former samples.txt + units.txt pair.

Required columns: Sample, Sequencing_Run, R1_fp, R2_fp

Sample   Sequencing_Run   R1_fp                       R2_fp                       Treatment_Group   Timepoint
John     Run_1            /path/John_R1.fastq.gz      /path/John_R2.fastq.gz      Treatment         1963
Paul     Run_1            /path/Paul_R1.fastq.gz      /path/Paul_R2.fastq.gz      Treatment         1963
Paul     Run_2            /path/Paul_L2_R1.fastq.gz   /path/Paul_L2_R2.fastq.gz   Treatment         1963
George   Run_1            /path/George_R1.fastq.gz    /path/George_R2.fastq.gz    Control           1963

One row per sequencing run: a sample sequenced on two lanes, or resequenced, gets one row per run with the same Sample value. The sample list is taken from the unique values of Sample, so no separate sample sheet is needed.

The _fp suffix marks the two columns that hold file paths. Paths may be absolute or relative to the working directory.

Any further columns are yours. Study covariates -- treatment, timepoint, subject, batch -- are carried through untouched and can be read inside a rule:

metadata_table.loc[(sample, seqrun), "Treatment_Group"]

Multiple runs for the same sample are concatenated by the merge_seqruns rule before assembly. A sample with a single run skips that rule entirely: its trimmed FASTQ is used directly, so nothing is copied or linked.

The table is validated on load. Missing required columns, empty required fields, duplicate (Sample, Sequencing_Run) pairs, and a file that is space- rather than tab-separated each produce a specific error naming the offending rows, rather than failing later inside the workflow.

Single-end runs

A run is single-end when R2_fp holds the literal NA:

Sample   Sequencing_Run   R1_fp                      R2_fp                      Treatment_Group
John     Run_1            /path/John_R1.fastq.gz     /path/John_R2.fastq.gz     Treatment
George   Run_1            /path/George_R1.fastq.gz   NA                         Control

Nothing is inferred. The layout is not detected from the filesystem, from read headers, or from a missing column, and a blank R2_fp is an error rather than an implicit single-end declaration. That is deliberate: a truncated or half-written sample sheet should fail loudly instead of quietly assembling one mate of a paired library. The marker is exact and case-sensitive, so na, n/a and None are all still errors.

Layout may vary between samples in one cohort, but not between the runs of a single sample. merge_seqruns concatenates per read identifier, so a sample mixing layouts would produce a reverse file covering only some of its runs; this is rejected on load.

Single-end samples differ from paired-end ones in three ways:

Paired-end Single-end
Read identifier R1, R2 SE
Assemblers megahit, metaspades megahit only
Trimmer fastp or cutadapt fastp only

metaSPAdes rejects a single-end-only library outright, so single-end samples are dropped from the metaSPAdes target list and assembled by MEGAHIT. With assemblers: [metaspades, megahit] a mixed cohort is handled correctly: paired-end samples are assembled by both, single-end samples by MEGAHIT alone, and generate_binning_config points each sample at an assembly that exists.

With assemblers: [metaspades] alone, a single-end sample has no assembler at all, and the run stops immediately with an error naming it. The check is deliberately at load time. Without it such a sample is trimmed, host filtered and profiled and only then dropped, so stage 1 reports success having produced no contigs for it and the first complaint comes much later from generate_binning_config.

The cutadapt parameters are paired-end specific (-U trims the reverse read), so trimmer: cutadapt is refused when the cohort contains single-end samples.

fastp runs with params.fastp.extra minus --detect_adapter_for_pe, which applies only to paired input; fastp detects adapter sequence for single-end reads by default. Set params.fastp.extra_se to override that derived value.

Single-end outputs never collide with paired-end ones: trimmed reads and their fastp reports go to output/qc/fastp/se/, host-filtered reads to output/qc/host_filter/nonhost/{sample}.SE.fastq.gz, and the host BAM to output/qc/host_filter/host_se/. Paired-end paths are unchanged, so adding single-end samples to an existing project does not invalidate work already done.

resources/test/metadata_single_end.txt and resources/test/metadata_mixed_layout.txt are runnable examples against the bundled test reads. The loader behaviour is covered by python3 resources/test/test_metadata_layout.py.

Migrating from samples.txt + units.txt

samples.txt is no longer used -- its only role was listing sample names, which metadata.txt already provides. Rename the units.txt header:

sed '1s/.*/Sample\tSequencing_Run\tR1_fp\tR2_fp/' units.txt > metadata.txt

then replace samples: and units: in your config with a single metadata: key. A config still using the old keys fails immediately with these instructions rather than a confusing error.


binning.txt (binning pipeline only)

Tab-separated. Defines which reads are mapped to which assemblies for binning. Columns: Sample, Contigs, Read_Groups, Contig_Groups.

This file is normally generated automatically by the generate_binning_config rule (see Running the pipeline). What it writes: every sample gets a Contigs path and a Contig_Groups label (so every assembly is binned), and only the n prototype samples get a Read_Groups label (so their reads form the differential-coverage basis).

Sample    Contigs                                        Read_Groups    Contig_Groups
John      output/assemble/megahit/John.contigs.fasta     Group1         Group1
Paul      output/assemble/megahit/Paul.contigs.fasta     Group1         Group1
George    output/assemble/megahit/George.contigs.fasta                  Group1
Ringo     output/assemble/megahit/Ringo.contigs.fasta                   Group1

Here John and Paul are the prototypes: their reads are mapped to all four assemblies. George and Ringo are still assembled and binned, just using the prototype coverage.

The mechanics, if you write the file by hand: samples that share a group label in both Read_Groups and Contig_Groups are paired — reads from every read-sample in a group are mapped to every contig-sample in that group.

  • A sample with a Contigs path and a Contig_Groups label contributes an assembly to that group.
  • A sample with a Read_Groups label contributes reads to that group.
  • A sample can belong to both.
  • A sample with neither label is present in metadata.txt but skipped by the binning pipeline.

Documentation home